home *** CD-ROM | disk | FTP | other *** search
- Newsgroups: bionet.software
- Path: sparky!uunet!stanford.edu!MED.Stanford.EDU!cmgm.stanford.edu!wnelson
- From: wnelson@cmgm.stanford.edu (Will Nelson)
- Subject: problem with blast
- Message-ID: <1993Jan21.231458.19512@medmail.stanford.edu>
- Keywords: blastn
- Sender: news@medmail.stanford.edu
- Organization: Stanford University, California, USA
- Date: Thu, 21 Jan 1993 23:14:58 GMT
- Lines: 59
-
- I have been having a problem with blastn.
- The problem is that on successive invocations of blastn,
- I get different results, using the same input sequence.
-
- My input file is this:
-
-
- >DROSATA - LOCUS DROSATA 254 bp ds-DNA INV 15-MAR-1989
- canatttgcaaatttaatgaaccccccttcaaaaaatgcgaaaattaacgcaaaaattgatttccctaaa
- tccttcaaaaagtaaataacaactttttggcaaaatctgattccctaatttcggtcattaaataatcagt
- ttttttgccacaactttaaaaataattgtctgaatatggaatgtcatacctcgcnnagctngtaattaaa
- tttccaatgaaactgtgttcaacaatgaaaattacatttttcgg
-
- Here is the beginning of the output of diff of the blast results:
-
-
- 1,4c1,2
- < Script started on Thu Jan 21 14:57:54 1993
- < cmgm.stanford.edu%<1>which script
- < /usr/ucb/script
- < cmgm.stanford.edu%<2>bl which blast
- ---
- > Script started on Thu Jan 21 15:00:08 1993
- > cmgm.stanford.edu%<1>which blast
- 6c4
- < cmgm.stanford.edu%<3>blast
- ---
- > cmgm.stanford.edu%<2>blast
- 60,69c58,67
- < DROSATA drosophila 1.688 g/ml satellite repeating unit. 1252 4.0e-97 1
- < DRO16883C D.melanogaster untranscribed DNA 1688-3C 459 1.6e-39 2
- < DROREP1 Repetitive DNA from Drosophila satellite fracti... 567 1.7e-38 1
- < DROSATB drosophila 1.688 g/ml satellite repeating unit. 567 1.7e-38 1
- < DRO1688ED D.melanogaster untranscribed DNA 1688-10Ed 490 7.0e-32 1
- < DRO1688EP D.melanogaster untranscribed DNA 1688-10Ep 466 7.8e-30 1
- < DROSAT353 D.melanogaster 1.688 g/ml satellite DNA sequence. 438 1.9e-27 1
- < DROARS413 d. melanogaster autonomous replication sequence... 355 2.0e-20 1
- < DROARS410 d. melanogaster autonomous replication sequence... 350 5.3e-20 1
- < DRODMRA D.melanogaster dispersed middle repetitive DNA ... 255 6.5e-20 2
- ---
- > DROSATA drosophila 1.688 g/ml satellite repeating unit. 1234 1.3e-95 1
- > DRO16883C D.melanogaster untranscribed DNA 1688-3C 450 5.4e-38 2
- > DROREP1 Repetitive DNA from Drosophila satellite fracti... 558 1.0e-37 1
- > DROSATB drosophila 1.688 g/ml satellite repeating unit. 558 1.0e-37 1
- > DRO1688ED D.melanogaster untranscribed DNA 1688-10Ed 481 4.1e-31 1
- > DRO1688EP D.melanogaster untranscribed DNA 1688-10Ep 457 4.5e-29 1
- > DROSAT353 D.melanogaster 1.688 g/ml satellite DNA sequence. 429 1.1e-26 1
- > DRODMRA D.melanogaster dispersed middle repetitive DNA ... 246 6.5e-20 2
- > DROARS413 d. melanogaster autonomous replication sequence... 346 1.2e-19 1
- > DROARS410 d. melanogaster autonomous replication sequence... 341 3.1e-19 1
- 71c69
- < DRODMRC D.melanogaster dispersed middle repetitive DNA ... 213 6.8e-17 2
-
- Has anyone else seen anything like this?
- --
- Will Nelson
- Computer Resource Administrator
- The Beckman Center at Stanford
- will@cmgm.stanford.edu
-