NetNews Usenet Archive 1992 #31/NN_1992_31.iso/spool/bionet/software/2343

Text File | 1992-12-30 | 25.6 KB | 611 lines

Newsgroups: bionet.software
Path: sparky!uunet!cis.ohio-state.edu!magnus.acs.ohio-state.edu!usenet.ins.cwru.edu!gatech!udel!darwin.sura.net!welchgate.welch.jhu.edu!danj
From: [e-mail] (Dan Jacobson)
Subject: Re: intron/exon borders
Message-ID: <[e-mail]>
Organization: Johns Hopkins Univ. Welch Medical Library
References: <[e-mail]>
Date: Wed, 30 Dec 1992 22:09:52 GMT
Lines: 600

In article <[e-mail]> [e-mail] (FRANK,BART) writes:
>Can anyone recommend a good program to screen human genomic seqeunces
>and predict positions of intros/exon borders?
>
>Thanks,
>Bart Frank
>Internet: [e-mail]

There are three mail servers which do this type of thing, namely
GRAIL, GENEID, and GENMARK.  I am including information about these
servers below.

Happy Holidays,

Dan Jacobson

[e-mail]



=========================================================================
////////////////////////////////////////////////////////////////////////
=========================================================================



Welcome to GRAIL (Gene Recognition and Analysis Internet Link)

Grail is an interface to a system which will ultimately provide
automated gene assembly from DNA sequence data.  Currently the
system provides analysis of protein coding potential of a DNA
sequence.  The coding recognition module (CRM) uses a multiple-
sensor neural network approach  to identify coding exons than are
at least 100 bases long.  In its current configuration the CRM
identifies 90% of such regions with less than 1 false positive
coding exon per 5 coding exons indicated. Your success rate will
depend on a number of parameters including the G/C content of
your sequence. In general, coding regions in sequences of low
G/C content are not as well recognized as those in higher G/C.
Investigation is underway to try and improve the performance
for low G/C sequences.

This part of the system is specifically designed to locate
regions of DNA sequence with protein encoding potential.  The
system has been trained to recognize coding regions in Human DNA
but seems to work well on DNA sequences from other mammals.
Because the system has not been tested extensively on species
other than human, no claims are made for the predictions of
coding potential on DNA's from other species.

To use GRAIL you must first register and get a user ID.
To become a registered user please send the following
e-mail message to:

    [e-mail]

Register
Your Name
Your address
Your phone number
your E-mail address

To have sequences analyzed send e-mail to:

     [e-mail]

The message will start with the word "sequences" followed by the
number of sequences you are sending followed by your user ID
followed by the sequences you wish to have analyzed in the
following format:

Sequences number_of_sequences  your_user_ID
>seq1name
AAAAAAAA........

>seq2name
TTTTTTTT..........

etc.

For the system to return any interpretation the sequence to be
analyzed must be at least 100 bases long (and not more than
100kb).  For each sequence the following information will be
returned:
1.  The score for the coding potential for each position analyzed
on each strand (the f-(forward) strand represents the sequence as
received, and the r-(reverse) strand is the reverse compliment).
These scores range from  0.0 to 1.0 and a score greater than 0.5
identifies a region with protein encoding potential. Non-coding
regions often have a score of 0.000. To reduce the output, only
regions with scores of at least 0.01 are reported.
2.  frame.  In calculating the coding potential, the system
calculates the reading-frame which is "preferred" in the window
over which the calculation is done and this information is
returned for regions with scores over 0.5.
3.  orf.  The limits between which the preferred frame is open is
returned for windows with scores over 0.5.

The second part of the output is the system's interpretation of
the raw data. This output gives the limits (in general a minimum)
of the extent of the coding exon, the most likely strand for the
exon with a probability for the correctness of the strand
assignment, the preferred reading frame for the exon and a
quality assessment.  An interesting phenomenon we have noted
is that some exons seem to have coding character on both strands
or even more coding character on the wrong strand. be aware that strand
assignments are not always correct, and it is sometimes useful to
consider both strands as possible. Any exon with a quality score of
"excellent" is worth further consideration.  Please remember that
the system is designed to find coding exon of 100 or more bases,
so small coding exons may well be missed.

This implementation of the CRM has been tested on a set of human
genes containing 102kb of sequence. This set contained 70 coding
exons and the system identified 62 (89%) and assigned them all to
the correct strand. (Though in a larger test set strand assignment
was 90-95% correct). The preferred reading frame assignment was
correct for 60 (96%) of these exons while the frame assignment
for the other two had some ambiguity. Of the eight missed 6 were
less than 100 bases long. Of 43 predicted exons with a quality
score of "excellent" all were actual coding exons. Of predicted
exons scoring "good" 11 of 16 (69%) were expected and of 49
predicted exons with a score of "marginal" only 8 (16%) were
"real". Though this is a rather limited test set, the results
of this analysis give some guidance for interpreting CRM output.

N.B.  This is an alpha+ version so we are open to feed-back.
We have a new e-mail address called [e-mail]
for user feedback to the GRAIL staff. Or communication can be
addressed specifically to us:

Direct questions to:  Richard J. Mural, e-mail:
     [e-mail]
     Phone: [phone]

or

Edward C. Uberbacher, e-mail:
     [e-mail]
     Phone: [phone]

or

GRAIL staff, e-mail:
     [e-mail]

To receive a copy of this help file send the message "help" to
     [e-mail].


-------------------------------------------------------------
Appendix A: GRAIL updates
-------------------------------------------------------------
Modifications to the GRAIL rule base for constructing the exon
table from the coding probability information have been made as
of Feb. 19, 1992. These changes have been designed to recognize
situations where a single real exon, usually with significant
extent, is recognized by GRAIL as multiple peaks or multiple exons.
These additional rules interconnect predicated peaks under
circumstances where consecutive predicated regions have the same
preferred reading frame, the frame is open between them, and they
are relatively close together. The result is generally a beneficial
simplification of the exon table and a more accurate representation
of exon structure. This also better adapts GRAIL for use with cDNAs.
Feedback or questions can be addressed to [e-mail].

  The GRAIL staff

===========================================================================
/////////////////////////////////////////////////////////////////////////
===========================================================================


>------------------------------ GENE-ID OUTPUT -------------------------------<


                              GENEID UPDATES

1. The top ranking gene model is now automatically compared to protein
   databases using the BLAST Network Service provided by the National
   Center for Biotechnology Information.  The results will be mailed to
   you separately and might give you some clues as to the function of
   your gene.

2. NETGENE is now available on this server. Just include the keyword line
   "NetGene" between the keyword line "Genomic Sequence" and your
   sequence.  More information is available in the info file which can be
   obtained by including the keyword line "geneid info".

3. GENEID was originally developed to predict the exon structure of
   full-length pre-mRNA. If the sequence does not contain first or last
   exons, then GENEID will still try to predict first and last exons,
   although they will tend to be short (<15 bp) and have low scores
   (<0.5). The lack of first or last exons may also affect the prediction
   of internal exons (see item 5. - 7. of the output). A future version
   will allow scanning for internal exons in small gene fragments.

4. If you have success in confirming GENEID predictions, we would like to
   hear about it. Send an email to [e-mail].

-------------------------------------------------------------------------------




      GENEID AND NETGENE ONLINE SYSTEMS FOR PREDICTION OF GENE STRUCTURE
                           version 1.0 2/1/1992

GENEID
_______________________________________________________________________________
Geneid is an Artificial Intelligence system for analyzing vertebrate genomic
DNA and prediction of exons and gene structure (1). A prototype is implemented
as a fast, automatic email-response system. Users have the option of having
their DNA sequence analyzed by NetGene (2) simultaneously.

REGISTRATION:
Before or simultaneously with submitting a sequence for analysis, you need to
register your name by sending a line with the word "register", followed by
your name and address. Example:

register, Don Johnson,  Miami Vice,  Baywiev Marina Dock A12,  Miami, FL  34566-
1234, U.S.A.

NOTE>>  The line can be longer than 80 characters as long as it contains NO
linebreaks, (that is, do NOT press the <Return> key until the end of the
address.)

Send the line in a mail to: [e-mail].  The registration
information will only be used for maintaining a file of the number and
geographic distribution of the users.

SUBMITTING SEQUENCES:
Your sequences must be submitted in the following format (approximately same
format as used for fasta, BLAST and GRAIL):
You can submit only one sequence per mail. Put the sequence after the keyword
"Genomic Sequence" as shown below:

Genomic Sequence

>seqname
TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC
CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG
GCCAACTCCATCACTA...................

(Restrict the line length to 80 characters. The seqname is limited to 20
characters).

NOTE>>  IF YOUR MAIL DOES NOT CONTAIN THE KEYWORD "GENOMIC SEQUENCE", OR
ANY OTHER KEYWORDS LISTED IN THIS FILE, NO MAIL WILL BE RETURNED TO YOU.

If the reply file with the results will exceed the Mail limit of 300
kB, the reply will be split into several files.  On a UNIX system you
could send the File containing the sequence as follows: mail -v
[e-mail] <File


LIMITS:
GeneId currently will not accept sequences smaller than 100 bp or larger
than 20 kb.

CONFIDENTIALITY:
Your submitted sequence will be deleted automatically immediately after
reception by GeneID.


ANALYSIS:
GeneID will scan your sequence for potential splice sites, startcodons, and
stopcodons. Then it will try to assemble these into potential first exons,
internal exons, and last exons. Exons will be evaluated according to a number
of characteristics related to coding and splicing, and only likely exons will
be kept. Mutually exchangeable exons (normally overlapping and in the same
frame) will be put together in classes. Only the top 15 ranking first and
last exon classes, and the top 35 ranking internal exon classes
from each sequence will be kept, and assembled into potential gene models with
open reading frame, that will be ranked according to quality of the exons
they contain. The top 20 models will be included in the return mail. Your
return mail will also contain lists of the sites and exons created during the
analysis. GeneID will not analyze the reverse complement of your sequence. If
you suspect a gene on the other strand, submit the reverse complement sequence
separately.

TIPS FOR USE OF GENEID:
GeneID will try to identify first, internal, and last exons in each of the
sequences you submit, and try to assemble these into models of ONE likely
gene in each sequence. To avoid missing any exons, the number of exons will
be vastly overpredicted, and only a few of them are likely to be true (they
tend to be the top ranking exons, but a few true exons rank very low). But
these few true exons are likely to be found in the gene models because they
fit together to form a continuous open reading frame. Thus you should look to
the gene models to find a probable coding region.
If you submit a sequence that turns out to contain two genes, the behavior of
GeneID is unpredictable. It could either predict one large gene containing
both, or it could predict only the gene with the most typical charateristics.
If you submit a sequence that contains only part of a gene, GeneID will try to
identify an entire gene in this sequence. Thus the predicted first exon may
actually be part of a true internal exon, or the predicted last exon may be
part of a true internal exon. If GeneID fails to predict any genes, you might
look at the potential exon lists.
Thus you can experiment with input and response, by starting out with sequences
that are not too long (for example less than 10 kb), and see if GeneID is
able to extend the gene if you extend the sequence. If you have very large
sequences, it may be a good idea to request analysis by NetGene first (see
below). NetGene will analyze sequences up to 100 kb, and may find regions
containing exons of very high likelihood. These regions can then be resubmitted
to GeneID for further analysis.
GeneID will not construct models with more than 22 exons.
If the sequence contains frameshift errors in exons, then that may affect the
quality of the prediction in the current implementation.

ACCURACY:
In a test on 28 genes from GenBank, 91% of the nucleotides were correctly
predicted as coding or non-coding. Since these two categories are unequally
represented, a better measure of accuracy may be the correlation coefficient,
which was found to be 0.68. See paper for details.

ANALYSIS TIME:
Will depend on the load on the system and grows approximately linearly with
the length of the sequence input. Expect at least 1 minute per kb. Longer
response times can occur if the system is temporarily down (check with the
UNIX command: "finger [e-mail]").

FURTHER INFORMATION:
A preprint of a paper describing the development and testing of GeneID is
available as a Stuffit.hqx file for Macintosh. Simply include the line:

  Preprint Request

in your mail to [e-mail], and the manuscript will be mailed to you.


REFERENCING:
Publication of output from GeneID must be referenced as follows:
(1) Guigo, R., Knudsen, S., Drake, N., and Smith, T. (1992) Prediction of Gene
Structure. Journal of Molecular Biology. 226:141-157.


PROBLEMS, COMMENTS, AND SUGGESTIONS:
Can be mailed to [e-mail].

Users of the MBCRR and BMERC national computer resources have direct
online access to GeneID from their account. Contact Tom Graf at
[e-mail] for information on these accounts.



NETGENE
________________________________________________________________________________
Users now have the option of having their submitted sequence analyzed by NetGene
also. NetGene predicts splice sites and gives information about the likelihood
of the prediction. NetGene detects both coding regions and splice signals, and
combines that information to predict both small and large exons (it predicts one
end of the exon, the acceptor or donor site).

Simply include the keyword "NetGene" between the keyword "Genomic Sequence"
and your sequence. The results of the NetGene analysis will be mailed to you
separately. The only difference in sequence format is that NetGene will accept
sequences UP TO 100 kb. Thus, NetGene can be used in conjunction with GeneID
by first submitting a large sequence to NetGene (specify the keyword "NetGene";
GeneID will not respond if the sequence is larger than 20 kb). Regions that
show exons with very high likelihood can then be resubmitted to GeneID (<20kb)
for further analysis. The minimum sequence length that NetGene will faithfully
analyze is 451 bp.

REFERENCING AND FURTHER INFORMATION
Publication of output from NetGene must be referenced as follows:
(2) Brunak, S., Engelbrecht, J., and Knudsen, S. (1991) Prediction of Human mRNA
Donor and Acceptor Sites from the DNA Sequence. Journal of Molecular Biology
220:49-65.

PROBLEMS, COMMENTS AND SUGGESTIONS:
Can be mailed to : [e-mail]



========================================================================
///////////////////////////////////////////////////////////////////////
========================================================================





          GENMARK : SYSTEM FOR PREDICTING PROTEIN CODING REGIONS
                           Version 1.1  4/15/92
                    (Internet Electronic Mail Server)


GENERAL INFORMATION

     GenMark is a software package available from the Georgia Tech
     School of Applied Biology  &  Office of Information Technology
     for the quick analysis of newly sequenced DNA.

     GenMark 1.1 is based on a special type of Markov chain model of coding
and noncoding nucleotide sequences. It proves to be a quite sensitive indicator
of protein coding regions in E.Coli and closely related species. The yield of
false positive predictions from the analysis of a 96bp segment is about 10%, for
false negatives, about 22.5% . The process for training the program for other
species is fairly straightforward, and new species will be added later, based on
demand and available information.

     GenMark is robust to the presence of ambiguities in newly sequenced DNA -
up to 10% of the sample DNA may be indicated by ambiguity symbols.

     GenMark receives its submissions from your local electronic mail service
and will reply with a list of open reading frames that it recognizes as protein
coding regions. There are also various other options, such as a PostScript(tm)
graph of the results, which may optionally be requested. GenMark should reply
within an hour of a sequence's submission by way of electronic mail.


SUBMISSION OF SEQUENCES FOR ANALYSIS

     Nucleotide sequences destined for processing should be sent via E-mail to:

    [e-mail]

The subject line of this message must contain one of three keywords:

     instructions
     registration
     genmark

     If the subject of the message is "instructions", GenMark will reply with
the most current submission instructions and news available on the system.

     If the subject of the message is "registration", your message will be
logged in a registration roster. It is NOT necessary to register in order to
use GenMark. If you decide to register, we ask that you include your name, your
E-mail address, and a brief list of the organisms which you would like to see
supported in future versions of GenMark (the family Enterobacteriaceae should
be fairly well represented by the E. Coli information).

     We will keep those persons who register informed with further developments
in the software and its options.

     If the subject of the message is "genmark", the program will try and
analyze the contents of the message as sequence information. The message
should minimally have the word "data" on a line by itself, followed by the
sequence information (see below for a discussion on how to supply options and
some example submissions).


SUPPLYING OPTIONS TO GENMARK

     No options are required for GenMark to function. The options specified
below just change the manner in which the program works. Only one option is
permissible per line. All of the options must occur before the keyword "data"
and the sequence information. ALL OF THE KEYWORDS MUST BE ENTERED IN LOWERCASE
LETTERS, the sequence itself doesn't matter.

     The options:

     #            A comment. The rest of the line, after this symbol, is
                  utterly ignored.

     address      Alternative E-mail address. After this option, include a
                  valid E-mail address to which the program should send the
                  output to (if it is different than the address from which
                  it was sent).

     name         The name of the person who submitted the sequence. This is
                  particularly important for sites where several people will
                  be submitting sequences from the exact same E-mail address.
                  After this option, include the name.

     order        The Markov chain order to use. If you don't know what this
                  is don't mess with it. Higher is better, up to a point. The
                  default is 4, though orders 1 through 5 are now available.
                  After this option, include the new order.

     psgraph      Give PostScript(tm) output. This instructs the program to
                  include a PostScript graph of the results which can be
                  printed on any PostScript compatible printer. The page is
                  divided into six horizontal panels with the probability
                  function on the y-axis, and the nucleotide position along
                  the x-axis. The six panels represent the six different frames,
                  panels 1-3 indicate frames 1-3 on the direct strand, and
                  panels 4-6 indicate frames 1-3 on complementary strand. Open
                  reading frame indicators appear along the middle of each
                  graph. Since there's a limit to the size of E-Mail messages,
                  expect the PostScript output to be sent as several messages.

     step         Set the window step. This must be stated as a multiple of
                  3 nucleotides. The default is 12. The practical upshot of
                  this setting, is that it allows you some freedom in adjust-
                  ing the resolution of the PostScript(tm) graph. For instance,
                  step setting of 3 gives 4 times the resolution of the default
                  of 12.

     threshold    Set the open reading frame threshold. This number is the
                  number between 0 and 1 (or between 0 and 100) that is the
                  minimum value of the probability function (a percentage)
                  that an open reading frame must have to be accepted as a
                  protein coding region. The default is 0.50.

     title        The title you want to give to your PostScript(tm) graph.

     window       The size of the analysis window (if you don't know what
                  this is, don't play with it). The default is 96 nucleotides
                  and generally 96 to 144 nucleotides works best.


SAMPLE SUBMISSIONS TO GENMARK

SAMPLE 1

> mail [e-mail]
Subject: genmark
# This example shows a minimal submission, just using the defaults set by
# the program.
#
# NOTE: this will reply automatically to the exact address that it was sent
# from with only a list of open reading frames.
#
# The actual DNA sequence may have any standard ambiguity DNA symbols in it
# Anything that isn't a letter (like numbers, punctuation, spaces, carriage
# returns) will just be ignored.
data
TCSSATGCATGHCATCGATWWCTCAGTCAGNA...


SAMPLE 2

> mail [e-mail]
Subject: genmark
# This is an example of using all of the different options.
address [e-mail]
name John Doe
order 5
psgraph
step 6
threshold 0.50
title John Doe's New Protein Coding Region
window 144
data
TCAGTTCCAAGGTTTCCCAAAGGGTTTTCCCCAAAAGGGG...


THINGS TO WATCH OUT FOR

     The sendmail program used for transferring messages across the network
is limited to messages that are 64000 characters long. Therefore, it is good
to remember to send any imformation you might have in chunks smaller than the
64000 character limit.

     The PostScript(tm) output might take up more space than is permissible
in a mail message so, GenMark will send the graphic in parts that are smaller
than 64K in length.

     If you shrink the step down to 3 and send a good sized sequence, the
PostScript(tm) output will be huge, so don't be suprised. Try and reserve doing
that for smaller sequences. For short sequences, you'll want to make the step
smaller. We suggest a step of 6 for any sequence under about 1.5kb long, and
a step of 3 for sequences less than about 800 bases long.

     Don't ask the program to make the step larger than the window. It won't
crash the program, but then again you'll probably just get garbage back.

     The sequences you send are deleted as soon as they have been processed
by the program. We cannot recover them for you. If you do not receive a
response in a couple of hours, something's wrong. Verify the format of your
submission and resend it.

     The graphic response may be effective for analyzing the intron/exon
structure of eukaryotic sequences, but there are no guarrantees. In such a
case, the list of open reading frames would almost certainly be useless, only
the graphic would make any sense.

     In many cases, the graphic output can tell you much more information
about the sequence in question than the open reading frame listing alone.
Careful evaulation of the graphic could yield clues as to sequencing errors
and frameshifts.


REFERENCES

Should you refer to the results of GENMARK analysis you should use
the following reference:

Borodovsky M. (1990) Recognition of coding regions in nucleotide sequences.
   In M.F.Frank-Kamenetskii ed. Computer analysis of Genetic Texts, Nauka,
   Moscow.

Borodovsky M. McIninch J. Prediction of Gene Locations Using DNA Markov Chain
   Models (Submitted to CABIOS).


QUESTIONS, PROBLEMS, SUGGESTIONS

Please send any comments or questions that you might have about the software
or the method of coding region recognition to:

     [e-mail]  (Mark Borodovsky)

or

     [e-mail]  (James McIninch)